Copyright (C) 2016 All rights reserved Kazusa DNA Research Institute
| Marker | CSES0065 |
|---|---|
| Motif | ATC |
| Fw_primer (5' to 3') | GCCTCAGATACGTAAAGGCG |
| Rv_primer (5' to 3') | CCAGCAGGAGGAGGTTGATA |
| Number of Repeats | 7 |
| Scaffolds | Cse_sc001457.1 |
| Positiona) | 75151 |
| Hits | Single |
a) The best hit positions of the first bases of the Fw primers were shown when multiple regions were hit.